Bay 57-1293
Oratests, through partnership with PA Labaratories Philippines, is able to offer samples of Bay 57-1293 for personal evaluation. We make no medical claims regarding this product, however within normal free speech rights we provide for you below the publicly available information on the safety and efficacy of Bay 57 for treating herpes in animals.

You will see that in the animal tests carried out, Bay 57 prevented new outbreaks and effectively eliminated viral shedding, when used either topically or orally, making it the most potent and effective treatment for herpes in animals known. No other drug has ever been shown to prevent future outbreaks.

Bay 57 is not an FDA approved drug. The pharmaceutical companies together, as if acting as a cartel, decided not to pay the millions required for regulatory approval to bring the product to market, because the drug would compete with the Acyclovir family of drugs that are currently profitably used to manage and never cure the disease. Some might question if the FDA and big pharma team are acting in the public interest, or if the public interest has little to do with their corporate/government teamwork in this case. The FDA has the legal authority to severely restrict free speech regarding any product, whether plant based or otherwise, that is sold. We therefore make no medical claims on this product and neither encourage nor discourage it's use for any medical reason. You may legally purchase the product, and you may legally read the studies that have been done about it.

It is noted that in the patent for Bay 57 a dosage for humans is recommended, and that a topical application is also recommended. Topical application was shown effective in animal models.

From the patent:

It has generally proved advantageous in order to achieve effective results to administer amounts of about 0.001 to 20 mg/kg, preferably about 0.01 to 10 mg/kg of body weight on intravenous administration, and the dosage on oral administration is about 0.01 to 30 mg/kg, preferably 0.1 to 20 mg/kg of body weight.

After oral (per os) administration BAY 57-1293 was at least 10 times more potent than valacyclovir even when applied once daily

Thus for a 60 kg animal the patent would suggest an oral dose of roughly 60mg. In animal studies the dose was given once or twice per day for a minimum of 4 days. Topical application was dissolved in alcohol.

Purchase of Bay 57-1293 must be made directly to PA Laboratories. The price is $195.00 for six 60 mg samples, including shipping. Samples are sent out by Fed Ex.

To send payment by credit card, echeck, or Paypal, please go to http://www.xoom.com , register an account, and make payment of $195 to:

Sarah Caballero
200 Sanciangko St.,
City: Cebu City
Zip:6000
Province: Cebu City
Phone: 09187230187
Item ID: Bay-57

And choose the option Deposit to bank account:
Metrobank
Account Number: 3169-11729-3
currency Philippine Peso
Sellers Email Address: palaboratories@cashette.com

PA Laboratories will be notified upon payment. Shipping is normally with 48 hours of receiving payment. Order enquiries should be directed to palaboratories@cashette.com
NEWS OF THE WEEK
MEDICINAL CHEMISTRY
April 8, 2002
Volume 80, Number 14
CENEAR 80 14 p. 11
ISSN 0009-2347
NEW LEADS FOR TREATING HERPES

Two compounds may offer better treatment of herpes diseases

MAUREEN ROUHI

Two research teams have developed compounds with impressive activity against herpes simplex virus (HSV), the cause of oral and genital herpes. The independent achievements come nearly 30 years after the introduction of acyclovir, the only effective drug now available. The compounds are orally active and act on a target that is different from acyclovir's. In animal models, they are more efficacious than acyclovir.

BILS 179 BS, the compound developed by James J. Crute and coworkers at Boehringer Ingelheim R&D centers in the U.S. and Canada, is effective against skin and vaginal lesions in animal models [Nat. Med., 8, 386 (2002)]. One advantage it has over acyclovir is that it can be used less frequently. It is also more effective in cases where treatment has been delayed.


NOVEL New compounds proposed for treatment of herpes, BILS 179 BS and BAY 57-1293, are unlike the drug in current use, acyclovir.
BAY 57-1293, the compound developed by Gerald Kleymann and coworkers at Bayer AG, Pharma Research, in Wuppertal, Germany, hastens the healing of lesions in animal models [Nat. Med., 8, 392 (2002)]. The compound "also blocks viral shedding nearly completely and may help control the further spread of genital herpes in the general population," Kleymann tells C&EN. "We have convincing data that show, for the first time, that recurrence of herpes disease may be prevented if the first episode is treated with BAY 57-1293," he adds.

The new compounds have enormous clinical implications, say Clyde S. Crumpacker and Priscilla A. Schaffer, professors of medicine at Harvard Medical School, in an accompanying commentary. If successfully developed into drugs, "they would represent a major advance in controlling HSV infections," they write.

Both compounds work by acting on two enzymes, helicase and primase, that are part of an enzyme complex HSV needs to untwist
its double-stranded DNA to form single strands and then prime the strands for replication into new viral DNA. By contrast, acyclovir targets DNA polymerase, the enzyme that acts on the primed single strand.

Different lines of evidence indicated that the helicase-primase complex is rate-limiting for HSV replication, according to Crute. Furthermore, the structure of the complex is well characterized, making it a good target for designing inhibitors, Kleymann explains.

Both compounds are more potent than acyclovir, which has limited bioavailability. Its potency is restricted by the fact that it must be phosphorylated by a viral enzyme before it can act on DNA polymerase. As many as one virus per thousand may not have the needed enzyme and thus not be sensitive to acyclovir, Crute notes. The new compounds, by binding to two targets simultaneously, mimic combination therapy with a single drug, Kleymann explains.







Helicase–primase inhibitors may treat herpes
Helicase–primase inhibitors are orally available drugs active against herpes simplex virus. |
The herpes simplex virus (HSV) causes cold sores and genital lesions and with the exception of acyclovir (an inhibitor of the viral DNA polymerase), there are currently no drug treatments available. Two papers in April Nature Medicine report helicase-primase inhibitors as a new class of orally available drugs active against HSV.

James Crute and colleagues from Boehringer Ingelheim Pharmaceuticals found potent selective thiazolylphenyl-containing inhibitors of the HSV helicase-primase enzyme. Inhibition of the enzymatic activities was through stabilization of the interaction between the helicase-primase and DNA substrates, preventing the progression through helicase or primase catalytic cycles. One compound — BILS 179 BS — was orally active and more effective than acyclovir against HSV infections in a murine model (Nat Med 2002, 8:386-391).

In a second paper, Gerald Kleymann and colleagues from Bayer AG, also reported a distinct, but structurally related inhibitor of the HSV helicase-primase with potent in vitro anti-herpes activity. Their compound — BAY 57-1293 — was well tolerated by mice, significantly reduced time to healing, prevented rebound of disease after cessation of treatment and reduced the frequency and severity of recurrent disease (Nat Med 2002, 8:392-398).

"The clinical implications for treatment with these new classes of orally available drugs are enormous. If helicase–primase drugs inhibit HSV infections more effectively than nucleoside analogs and exhibit safety parameters comparable with acyclovir, they would represent a major advance in controlling HSV infections," wrote Priscilla Schaffer of Beth Israel Deaconess Medical Center in an accompanying News and Views article. But compounds that can block the latent stage of the virus also need to be developed, she cautioned.



The herpes simplex virus (HSV) is responsible for the cold sores and genital herpes that plague a great many people. Fortunately, the introduction of acyclovir in the 1970s has offered widespread relief for these conditions. Yet since that time, no new class of anti-herpes drugs has been created--until now.

In the April issue of Nature Medicine (Vol. 8, No. 4, 01 Apr 02, p. 386 & 392), two leading pharmaceutical companies report the development of new compounds to thwart the virus. Both of the new compounds target the virus in the same way, but one that is different to acyclovir. While all three block the synthesis of the virus’ DNA, the new compounds do so by inhibiting the action of a helicase-primase enzyme complex, whereas acyclovir blocks the polymerase enzyme. Because the new compounds work differently to acyclovir, they may be useful in cases of resistance against acyclovir.

Gerald Kleymann and colleagues at Bayer AG found that BAY 57-1293 speeds up the healing of herpes lesions in a mouse model of the disease and reduces the severity and frequency recurrent disease. Similarly, James Crute and colleagues of Boehringer Ingelheim Pharmaceuticals report that BILS 179 BS is highly effective against skin and vaginal herpes lesions in a mouse model of disease.

Both compounds are more potent than acyclovir and are orally active. In an accompanying News & Views article (p. 327), Priscilla Schaffer of Beth Israel Deaconess Medical Center writes, “If helicase-primase drugs inhibit HSV infections more effectively than nucleoside analogs…they would represent a major advance in controlling HSV infections.” But she explains that compounds that can block the latent stage of the virus also need to be developed.

Article


Nature Medicine 8, 392 - 398 (2002)
doi:10.1038/nm0402-392
New helicase-primase inhibitors as drug candidates for the treatment of herpes simplex disease
Gerald Kleymann, Rüdiger Fischer, Ulrich A.K. Betz, Martin Hendrix, Wolfgang Bender, Udo Schneider, Gabriele Handke, Peter Eckenberg, Guy Hewlett, Veniamin Pevzner, Judith Baumeister, Olaf Weber, Kerstin Henninger, Jörg Keldenich, Axel Jensen, Jörg Kolb, Ute Bach, Andreas Popp, Jutta Mäben, Isabelle Frappa, Dieter Haebich, Oswald Lockhoff & Helga Rübsamen-Waigmann
Bayer AG, Pharma Research, Wuppertal, Germany




The vast majority of the world population is infected with at least one member of the human herpesvirus family. Herpes simplex virus (HSV) infections are the cause of cold sores and genital herpes as well as life-threatening or sight-impairing disease mainly in immunocompromized patients, pregnant women and newborns. Since the milestone development in the late 1970s of acyclovir (Zovirax), a nucleosidic inhibitor of the herpes DNA polymerase, no new non-nucleosidic anti-herpes drugs have been introduced. Here we report new inhibitors of the HSV helicase-primase with potent in vitro anti-herpes activity, a novel mechanism of action, a low resistance rate and superior efficacy against HSV in animal models. BAY 57-1293 (N-[5-(aminosulfonyl)-4-methyl-1,3-thiazol-2-yl]-N-methyl-2-[4-
(2-pyridinyl)phenyl]acetamide), a well-tolerated member of this class of compounds, significantly reduces time to healing, prevents rebound of disease after cessation of treatment and, most importantly, reduces frequency and severity of recurrent disease. Thus, this class of drugs has significant potential for the treatment of HSV disease in humans, including those resistant to current medications.


Eight human herpesviruses (HHV1 to HHV8) have been identified so far1. One key feature of these viruses is their ability to remain latent in their host after primary infection and to reactivate intermittently from a pool of latently infected cells upon diverse internal and external stimuli. The HHV genomes (dsDNA 125−230 kb in size) code for more than 50 genes that are essential for viral replication in vitro and/or in vivo and many viral gene products are potential targets for antiviral therapy. High-sequence homologies have been identified in HHV genes encoding the helicase-primase enzyme complex, which is essential for DNA and viral replication2.

Acyclovir (trade name Zovirax)3, developed in the late 1970s, was the first specific and selective antiviral drug. Newer nucleosidic drugs4 that are chemically related to acyclovir, such as penciclovir or their pro-drugs valacyclovir (Valtrex) and famcyclovir (Famvir), were launched in the mid 1990s. However, nucleosides are pro-drugs that have to be phosphorylated by the viral thymidine kinase (TK) and subsequently by cellular kinases in order to inhibit the viral DNA polymerase. If the virus does not express a functional TK (for example, a resistant HHV1 strain or TK- viruses such as human cytomegalovirus) or if the DNA polymerase does not have the optimal primary structure, the potency of the drug diminishes, the selectivity index is significantly smaller, higher doses have to be administered and adverse effects are more likely to be associated with treatment. Until now, nucleosides were the only compound class available for systemic treatment of herpes disease and resistance was developing in the growing number of immunocompromized patients. Thus, potent anti-herpes activity, efficacy (especially upon delayed treatment), safety and lack of cross-resistance to nucleosides were the key criteria in the search for the next generation of drugs directed against novel targets of herpesviruses.

Identification and optimization of antiviral compounds
We have used a new fluorometric high-throughput screening (HTS) assay to identify active and tolerable substances in compound libraries that inhibit any target essential for viral replication in cell culture5, 6. Efficacy of a test sample is measured by assessing the viability and proliferation of surviving cells in a herpes simplex virus (HSV)-infected cell culture with a fluorescent dye at the time when cell viability in the virus (no-drug) control approaches zero. Approximately 4.2 105 compounds were tested at a concentration of 10 M and several compound classes with antiviral activity were discovered. Starting with the identified compound BAY 38-9489 (ref. 5), several thousand analogs and new compounds were synthesized during consecutive optimization cycles of synthesis, biological profiling and modeling techniques to optimize the thiazole urea BAY 38-9489 to the lead structure BAY 44-5138 (ref. 5). BAY 44-5138 showed first in vivo activity, and finally BAY 57-1293 (ref. 6) was optimized and selected for pre-clinical development (Tables 1 and 2). The structure−activity relationship (SAR) and selected examples that illustrate the progress during the optimization phase are summarized in Table 1 and 2 and briefly outlined below.


Table 1. Pharmacological profile of the helicase primase inhibitors



Full Table



Table 2. Antiviral activity of compounds in vivo (10 mice per group)



Full Table


SAR of the novel herpes inhibitors
Replacement of the morpholino group in BAY 44-5138 by a phenyl ring and the observation that BAY 44-5138 is demethylated in vivo led to BAY 51-3295, the first compound that was more potent than valacyclovir in vivo. Exchanging the urea moiety with an amide group (BAY 54-6322) and introduction of the primary sulfonamide resulted in BAY 56-1655, a remarkably potent compound in vitro (50% inhibitory concentration (IC50) < 0.01 M (HSV-1 F and HSV-2 G) and in vivo (50% effective dose (ED50) = 0.5 mg/kg (HSV-1 Walki) and 1.1 mg/kg (HSV-2 MS)). However, solubility of the compounds BAY 51-3295 and BAY 56-1655 was too low for simple intravenous formulation. The 2-pyridyl substituent in para-position of the phenyl ring in BAY 57-1293 solved this problem and this compound was selected for in-depth characterization of its biophysical properties as well as its pharmacokinetic, pharmacodynamic and safety profiles.

Physical and chemical properties of BAY 57-1293
The systematic name of BAY 57-1293 within the IUPAC nomenclature is N-[5-(aminosulfonyl)-4-methyl-1,3-thiazol-2-yl]-N-methyl-2-[4-
(2-pyridinyl)phenyl]acetamide with the sum formula C18H18N4O3S2 and a molar mass of 402.5 g/mol. The compound is a stable white powder at room temperature with a melting point of 193 °C (decomposition).

Biological and medicinal profile of BAY 57-1293
The concentration at which a drug reduced cytopathic effects (CPE) of viral replication (IC50) or cell viability (Tox50) in cell culture by 50% as well as the selectivity index (SI = Tox50/IC50), a measure of tolerability in vitro, are listed in Table 1. The first identified compound, BAY 38-9489, was tolerable over a broad concentration range and at least as active as acyclovir in vitro (Fig. 1). The IC50 of the optimized compound BAY 57-1293 was determined to be 0.012 0.004 M (median, sextuplicate experiment). The results of the fluorescence-based assay5, 6 are comparable with those obtained from conventional cytopathogenicity or plaque reduction assays7, 8, 9. The inhibitory dose (ID50), inhibitory or effective concentration (IC50 or EC50) of the plaque reduction assay or the cytopathogenicity assay denotes the drug concentration that reduces the number of viral plaques or viral-induced cytopathogenicity (CPE, lysis or morphological changes of infected cells) by 50% as compared with the untreated control (infected cell culture). The IC50 of the new fluorescence-based cytopathogenicity assay stands for the drug concentrations that block the decay of the esterase activity of an infected cell culture in the presence of compound by 50% at the time when the esterase activity of the untreated control (infected cell layer) approaches zero (signal of control cells divided by signal of the virus control (infected cells) > 10). The fluorescence signal (esterase activity) corresponds with the number of vital or viable cells in the test well; figuratively speaking, the IC50 is the drug concentration at which the microscopic picture of an infected cell culture in the presence of compound shows 50% CPE. The IC50 values of the plaque reduction assay (IC50 acyclovir = 0.4−0.75 M; IC50 BAY 57-1293 = 0.01−0.02 M) and the conventional cytopathogenicity assay (IC50 acyclovir = 0.5−1.5 M; IC50 BAY 57-1293 = 0.01−0.03 M) were determined for comparison on Vero cells infected with HSV-1 F.


Figure 1. Antiviral effect of inhibitors in vitro.

Dose-dependent anti-herpes activity of the screening hit BAY 38-9489 (IC50 = 0.5 M) and development candidate BAY 57-1293 (IC50 = 20 nM) compared with acyclovir (IC50 = 1 M) determined with the fluorescence-based cytopathogenicity assay5, 6. The quotient of relative fluorescence units of an infected well in the presence of test sample and the uninfected cell control is shown in percentage. Representative results of 10 experiments are shown. The s.d. for a given concentration is generally between 2−8% and at concentrations approaching the IC50 values, less than 25%. , acyclovir, HSV-1 F; , BAY 38-9489 HSV-1 F; , BAY 57-1293 HSV-1 F; , BAY 57-1293 HSV-1 clinical isolate; , BAY 57-1293 HSV-2 clinical isolate.



Full Figure and legend (21K)


BAY 57-1293 is nearly two orders of magnitude more potent than acyclovir in vitro and the superiority was even more prominent when the viral load was increased (BAY 57-1293 IC50 = 12 nM, 20 nM and 50 nM; acyclovir IC50 = 1 M, 3 M and 10−50 M at a multiplicity of infection (m.o.i.) of 0.0025, 0.02 and 0.2, respectively). A minor increase in IC50 values at higher viral loads was observed for all thiazolyl compounds listed in Table 1. BAY 57-1293 was also active against porcine (IC50 = 5 M) and bovine (IC50 = 0.12 M) herpes strains; however, only weak activity was observed against varicella-zoster virus or human cytomegalovirus. Inhibition of viral replication in vitro was completely reversible upon removal of the drug whereas the delayed addition of inhibitor up to 6−10 hours post-infection (p.i.) left the IC50 values nearly unchanged. Similar results upon delayed addition of inhibitor have been reported for acyclovir, which indicates that both the thiazolyl and nucleoside compounds block viral replication during gene expression, albeit as a result of different mechanisms. BAY 57-1293 was active at an IC50 of 10−30 nM against all clinical isolates of HSV-1 (from 35 patients) and HSV-2 (from 19 patients) tested so far with near identical IC50 values to those seen with HSV-1 F and HSV-2 G (Fig. 1 and Table 1) as well as HSV-1 Walki (IC50 = 20 nM) or HSV-2 MS (IC50 = 15 nM). The same antiviral activity was also observed on permissive cell lines of epithelial (human embryonic lung fibroblasts and normal human diploid fibroblasts) and neuronal origin (NT-2, HSV-1 F, IC50 = 20 nM) when viral titers were determined on the respective cell lines and cell culture conditions were comparable. Finally, BAY 57-1293 was active against acyclovir resistant mutants (Table 1), which display mutations in the TK and/or pol genes10, with nearly identical IC50 values observed for HSV-1 F or clinical isolates (Fig. 1).

Mechanism of action
To elucidate the mechanism of action of the inhibitors presented here, we analyzed the influence of compounds on individual steps of the replication cycle at several time points after infection. In the presence of BAY 57-1293, the virus still infected permissive cells and expression of viral immediate early genes was initiated. However, PCR, Southern-blot and in situ hybridization analyses demonstrated complete inhibition of viral DNA synthesis. In agreement with these findings, electron microscopy showed a total absence of DNA-containing C-capsids, which normally bud from infected cells as enveloped infectious viruses. Reverse transcriptase (RT)-PCR experiments revealed that only immediate early genes are expressed normally in the presence of inhibitor, whereas early and late gene expression is reduced, suppressed or not initiated (Fig. 2). In parallel to this line of experiments, 10 drug-resistant HSV mutants were selected in the presence of 0.5−2.0 M inhibitor. The frequency at which mutant HSV-1 F viruses appeared in vitro (0.5−4.5 10-6) is at least one order of magnitude lower compared with acyclovir (1 10-3−1 10-4)10. When cells were transfected with a variety of PCR fragments obtained from drug-resistant viruses and subsequently infected with wild-type virus in the presence of inhibitor, viral plaques were detected only when cells were transfected with a mutant UL5 or UL52 gene or a mix of mutant UL5 or UL52 and wild-type UL5, UL8 and UL52 genes, but not when cells were transfected with a wild-type UL5, UL8 or UL52 gene (data not shown). From these complementation experiments, we concluded that the helicase-primase complex (UL5 and UL52 gene products) is the target of the thiazole ureas and their corresponding amides. Furthermore, sequencing of the complete genome of a virus resistant to BAY 54-6322 revealed a single mutation (UL5, K356N). Sequencing of partial genomes and individual genes of nine other mutants localized all resistance-conferring mutations to the UL5 and UL52 genes. The observed mutations and resistance indices were irrespective of the permissive cell type and are summarized in Table 1.


Figure 2. Compounds inhibit early and late gene expression.

a−f, Agarose gel electrophoresis of RT-PCR fragments prepared from virus (HSV-1 F) infected cell cultures (Vero cells) in the presence of compound BAY 57-1293 (a, c, e; 2 M) shows inhibition of (c versus d; UL8, 12 p.i.) and (e versus f; UL13, 16 p.i.) gene expression. Identical results were obtained with BAY 44-5138 (25 M). gene expression is not altered in the presence of inhibitor (a versus b; UL54, 2 p.i.).



Full Figure and legend (32K)


The mutations in the UL5 gene of HSV-1 were mainly found between nucleotides 1045 to 1077 corresponding to amino acids 349 to 359 (the -helical stretch HEFGNLMKVLE), which is also the region of highest homology among the UL5 sequences of the herpesviridae and just adjacent to the conserved motif IV of the six protein domains required for helicase activity11. Mutant virus K356N replicated with near wild-type growth rate and titers comparable to wild-type virus were obtained, whereas other mutants such as M355T were strongly impaired with respect to growth rate and titers. In addition to the complementation analysis and the sequencing results (Table 1), the mechanism of action of BAY 57-1293 and congeners was also confirmed by direct inhibition of the ATPase activity of the viral helicase-primase enzyme complex in a dose-dependent manner (Table 1).

Superior anti-herpes activity of BAY 57-1293 in vivo
We used a murine model of disseminated herpes infection (lethal challenge model)12, 13 to assess the antiviral activity of the compounds in vivo. Potential drug candidates were tested in escalating doses and the ED50 was determined. The results for selected compounds are summarized in Table 2. After oral (per os) administration BAY 57-1293 was at least 10 times more potent than valacyclovir (Table 2), even when applied once daily (Fig. 3a). Superior efficacy and potency of BAY 57-1293 was also demonstrated in a model of cutaneous HSV infection (Fig. 3b; zosteriform spread model)14 when oral treatment was initiated after onset of disease and herpes vesicles were already apparent. In particular, after treatment was stopped, the rebound of disease was more effectively controlled in BAY 57-1293-treated animals.


Figure 3. Potency and efficacy of compounds in HSV-infected mice.

a and b, Superior potency and efficacy of BAY 57-1293 compared with the nucleoside analog valacyclovir (Valtrex) in the murine lethal challenge12, 13 (a) and zosteriform spread model14 (b). a, Comparison of BAY 57-1293 with valacyclovir in the murine lethal challenge model. 10 anesthetized BALB/cABom female mice per group were intranasally infected with a lethal dose of HSV-2 MS and treated per os with BAY 57-1293 or valacyclovir once daily from d0 to d4 post infection. Infected mice were inspected daily and a survival curve was recorded. The comparison of survival curves was performed using the generalized Wilcoxon test. All treatment groups yielded statistically significant different survival curves. , placebo; , valacyclovir 60 mg/kg; , BAY 57-1293 7 mg/kg. b, Comparison of BAY 57-1293 with valacyclovir in the zosteriform spread model14. The scarified skin of C3H/TifBom-hr female mice was infected with 1 106 p.f.u. HSV-2G and the disease score (mean of 10 animals per group; see Methods) was recorded daily. Delayed treatment (15 & 60 mg/kg BAY 57-1293 and 60 & 240 mg/kg valacyclovir, 0.5% Tylose/PBS, 3 daily, per os) commenced on d3 post infection and continued until d7. Sum of disease scores were compared between treatment groups using one-way ANOVA. In order to account for multiple testing, resulting P-values were adjusted according to Bonferroni−Holm. Treatment with 15 mg/kg BAY 57-1293 was more effective compared with treatment with 240 mg/kg valacyclovir (P < 0.011). , placebo; gray diamond, valacyclovir 60 mg/kg; , valacyclovir 240 mg/kg; gray triangle, BAY 57-1293 15 mg/kg; , BAY 57-1293 60 mg/kg.



Full Figure and legend (40K)


The guinea pig model of intravaginal HSV-2 infection resembles the clinical situation in humans15. BAY 57-1293 was found superior to valacyclovir in this model when acute treatment (Fig. 4a−c), delayed treatment (Fig. 4d) or suppression of recurrent disease was measured in terms of a disease score (Fig. 4e). BAY 57-1293 not only completely suppressed clinical symptoms of primary disease (Fig. 4a−c) but also suppressed viral shedding by 3 orders of magnitude to nearly undetectable levels in vaginal swabs (mean plaque-forming units (p.f.u.) per ml log 0.6 0.6 for BAY 57-1293-treated animals in comparison to log 3.7 0.8 for placebo-treated animals). Treatment of acute disease also prevented recurrent disease symptoms in the follow-up period (Fig. 4e). Delayed initiation of therapy after appearance of vesicles showed that BAY 57-1293 was clearly more efficacious than valacyclovir in reducing time to healing (Fig. 4d) in guinea pigs.


Figure 4. Potency and efficacy of compounds in HSV-2-infected guinea pigs. Suppression of acute disease symptoms (photographed at d6 p.i.) of 10 vaginally infected (2.5 105 p.f.u. HSV-2 strain MS) female guinea pigs per group.

a−c, Animals treated with BAY 57-1293 (20 mg/kg, disease score 0) (a), valacyclovir (150 mg/kg, disease score 2) (b) and placebo (disease score 4) (c). Redness, swelling and herpetic vesicles are observed only in placebo- and valacyclovir-treated animals. d, Time to healing after late treatment of vaginally HSV-2 infected guinea pigs15 with BAY 57-1293 () in comparison with valacyclovir () and placebo (). Delayed treatment with BAY 57-1293 (20 mg/kg 2 daily per os, treatment day 4−14) abrogates progression of disease symptoms (mean of 10 animals per group) of HSV-2 infected guinea pigs within 1 d of treatment and healing is observed subsequently, whereas a 7.5 - fold higher dose of valacyclovir (150 mg/kg 2 daily) shows marginal therapeutic efficacy compared with placebo. Time to healing in the BAY 57-1293 group was significantly shorter than in the valacyclovir-treated group. e, Influence of acute treatment on the recurrence rate of HSV-2 infections in the guinea pig model15. BAY 57-1293 reduces recurrent HSV-2 disease almost completely when vaginally HSV-2 infected guinea pigs were treated 2 daily per os with 30 mg/kg from d0−d4 (acute treatment; treatment start 6 h post infection). In this experiment valacyclovir (3 daily with 100 mg/kg; gray line) had no effect compared with placebo (dashed line), whereas BAY 57-1293 treated animals (2 daily 30 mg/kg; black line) show only very few recurrent episodes. Graph shows cumulative disease score over time of recurrent genital herpes in the guinea pig model (mean of 10 animals per group).



Full Figure and legend (34K)


Pharmacokinetic and safety profile of BAY 57-1293
When female BALB/c mice were treated with a single dose of 1 mg/kg BAY 57-1293 per os as suspension in 0.5% tylose, a maximal concentration of 1.8 mg/l (4.4 M) was reached 1 hour after administration. Due to the slow elimination of BAY 57-1293 (t1/2 = 6.0 h), plasma concentrations above 100 g/ml (0.25 M) were detected up to 24 hours after dosing. Similar favorable pharmacokinetics with a high bioavailability (> 60%) were also observed in rats and dogs.

Exploratory toxicology and safety pharmacology studies did not reveal any safety relevant findings at 30, 100 and 300 mg/kg BAY 57-1293 (once daily per os) in a 4-week chronic toxicity study in dogs. However, administration of the same dose to rats for 4 weeks resulted in a dose-dependent transitional hyperplasia of the urinary bladder epithelium. The N-[5-(aminosulfonyl)-4-methyl-1,3-thiazol-2-yl]-N-methylacetamide moiety of BAY 57-1293 resembles the structure of the diuretic drug Diamox (acetazolamide). Primary sulfonamides can inhibit rat, dog and human carbonic anhydrase enzymes and are known to cause a species-specific hyperplasia in bladder epithelium of rodents, but not in other animals or humans. In contrast to acetazolamide, which has an IC50 of approximately 30 nM, BAY 57-1293 inhibits the carbonic anhydrase with an IC50 in the range of 2−5 M in the standard carbonic anhydrase−catalyzed CO2 hydration test system (data not shown). Due to the high exposure, which reached 100−300 M in rats, it is likely that the hyperplasia observed in rats is in fact due to the carboanhydrase inhibition by BAY 57-1293.

Discussion
The best strategy for control of disease caused by pathogens such as HSV would obviously be prevention. Rising incidence data show that it is difficult to avoid new infections due to the insufficient awareness of the problem within the population and the high prevalence and contagious nature of the virus. In view of the significant challenge associated with the development of a prophylactic vaccine that can block HSV infections of mucosal surfaces and the limited use of antibodies, therapeutic proteins and immunostimulants, treatment with an orally available, small-molecule antiviral drug amenable to large-scale production is a proven option to treat HSV infections3, 4, 7. However, although the nucleosidic drugs on the market represented a major breakthrough, their efficacy is limited, particularly when they are administered late after onset of disease.

The preclinical pharmacological profile of the new helicase-primase inhibitor BAY 57-1293 is superior to the current standard HSV treatment represented by Zovirax, Valtrex and Famvir with respect to all parameters of efficacy. BAY 57-1293 is not only more potent in vitro and in vivo by at least one order of magnitude, it is especially efficacious when treatment is delayed or the viral load is increased, features essential for treatment of herpes encephalitis and disseminated disease. Importantly, recurrent disease and asymptomatic virus shedding are nearly completely suppressed by the helicase-primase inhibitors, which should decrease person-to-person transmission. As some of the disease syndromes caused by HSV are common, relatively benign and self-limiting, the therapeutic index of an anti-herpes drug must be extremely high for broad application. The new selective and specific mechanism of action meets this requirement and because it differs from the mechanism of nucleosidic drugs it also satisfies the strong medical need to combat nucleoside drug resistance, especially in immunocompromised patients.

The remarkable potency of the new compound class may be explained by the pattern of resistance-conferring mutations in the genes encoding UL5 and or UL52. It can be concluded that the thiazolyl-amides bind to the helicase and primase subunits simultaneously thereby mimicking combination therapy with a single drug. Although all selected resistant viruses displayed mutations in the viral helicase and/or primase subunits we cannot rule out that a further target such as UL8 may be identified, thereby increasing the incidence of resistant viruses under selection pressure. However, the lower resistance rate in vitro compared with acyclovir, which targets the viral thymidine kinase and DNA-polymerase, argues against this possibility.

The physicochemical properties of BAY 57-1293 permit the development of topical, oral and intravenous formulations to suppress or treat primary and recurrent HSV diseases such as herpes labialis, herpes genitalis, ocular herpes infections, encephalitis and disseminated or visceral HSV infections. The potency of BAY 57-1293 in the lethal challenge model and the efficacy regarding the reduction of the recurrence rate after treatment of a primary infection are encouraging for the initiation of trials in humans, but one has to be cautious in predicting the clinical benefit in humans from animal studies due to different parameters among species such as metabolism and pharmacodynamics.

Nevertheless, it seems likely that BAY 57-1293 will further reduce mortality and morbidity for life-threatening HSV disease as well as decrease the establishment of latency and subsequent relapse. Clinical trials will now have to show whether the in vitro activity, the efficacy in animal models and the favorable pharmacokinetic and safety profiles open the way to a novel once daily, non-nucleoside treatment of diseases caused by HSV.

Top



Methods
Animals, cells and viruses.
BALB/cABom female mice (weight, 19 g; age, 7 wk) and C3H/TifBom-hr female mice (age, 7 wk) were purchased from M&B A/S (Ry, Denmark) whereas female Hartley guinea pigs were purchased from Charles River Laboratories (Wilmington, Massachusetts) or Harlan & Winkelmann (Borchen, Germany). Cells (Vero (African green monkey) kidney cells), human embryonic lung fibroblasts, normal human diploid fibroblasts and viruses were obtained from ATCC (American Type Culture Collection, Manassas, Virginia) or DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany) and cultivated according to standard procedures8. Animals were housed according to German animal protection laws, guidelines and approval.

Fluorescence based cytopathogenicity assay.
1 104 Vero cells per well of a microtiter plate (MTP) were infected with 25 p.f.u. of herpes simplex virus (HSV-1 F or clinical isolates of HSV-1 or 2; multiplicity of infection (m.o.i. = 0.0025)) in a total volume of 200 l media (M199 medium supplemented with 5% FCS, 2 mM glutamine, 100 IU/ml penicillin and 100 g/ml streptomycin) in the presence or absence of drug and incubated for 5 d at 37 °C, 5% CO2. The wells of the MTP were washed with PBS (200 l) and then filled with 200 l PBS containing 10 g/ml fluorescein diacetate. After a 45-min incubation at room temperature, fluorescence was measured at 485 nm excitation and 538 nm emission wavelengths. IC50 values were determined by a nonlinear plot of antiviral activity as a function of drug concentration5, 6.

Agarose gel electrophoresis of RT-PCR fragments prepared from virus infected cell cultures.
5 106 Vero cells were seeded in tissue culture flasks and incubated over night at 37 °C, 5% CO2. The cells were infected (m.o.i. = 1) with HSV-1 F in the presence and absence of BAY 57-1293 (2 M). Identical results were obtained with BAY 44-5138 (25 M).

The RNA of infected cells was purified at 2 h (UL54), 12 h (UL8) and 16 h (UL13) after infection (Qiagen, Hilden, Germany) RNA purification (RNeasy kit; 40 l elution) and quantified (absorption at 260 nm). The RNA (2 g) was reverse transcribed with a specific primer (2 pmol; UL54, 5' AAACAGGGAGTTGCAATAAA 3'; UL8, 5' GGCAAACAGAAACGACATCT 3'; UL13, 5' CGACAGCGCGTGCCGCGCGC 3') into cDNA according to the Superscript II protocol (Invitrogen, Karlsruhe, Germany). Aliquots (2 l) of the reverse transcription reaction were amplified by PCR. A 300-bp fragment of the HSV UL54 gene, a 350-bp fragment of the UL8 gene and a 600-bp fragment of the UL13 gene were amplified in 30 cycles (UL54 and UL8: 3 min, 94 °C hot start; 1 min, 94 °C denaturation; 1 min, 55 °C annealing; 1 min, 72 °C polymerization. UL13: 3 min, 94 °C hot start; 1 min, 94 °C denaturation; 1 min, 60 °C annealing; 1 min, 72 °C polymerization.) by PCR (Taq-Polymerase, Stratagene, Amsterdam Zuidoost, The Netherlands), in a 100-l reaction volume with the following oligonucleotides: UL54, 5' GCC TGT GCG GCC TGG ACG AA 3' and 5' AAT ATT TGC CGT GCA CGT AC 3'; UL8, 5' CGCCTGCGACCGCCTTATCT 3' and 5' TGTCGTCAAAGGGATACACA 3'; UL13, 5' CGATCGCCCGGGGGCAGTTT 3' and 5' ACGGGTTGGTGTGACACAGG 3'; 0.1 nmol each. 8-l aliquots of cycle 20−30 (lanes 2−12) of the PCR were resolved on a 2% agarose gel (Invitrogen) according to the manufacturer's instructions.

Cloning and preparation of the helicase-primase enzyme.
HSV-1 helicase-primase heterodimer was produced in doubly infected Sf9 (Spodoptera frugiperda) cells using recombinant baculoviruses expressing the UL5 and the UL52-6xHis genes of the helicase-primase subunits. The genes were amplified by PCR from HSV-1 F (American Type Culture Collection ATCC VR-733) and cloned into the baculovirus expression system (UL5, pFASTBAC1; UL52, pFASTHTb) according to the Instruction Manual BAC-TO-BAC Baculovirus (Expression Systems, Invitrogen, Karlsruhe, Germany). The heterodimeric enzyme was purified by IMAC-Chromatography as described16.

ATPase Assay.
Purified heterodimeric helicase-primase complex (200−400 ng) was incubated with 1 g DNA (Sigma D3287 or D8681) in 20 mM HEPES (pH 7.6; 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 5 mM MgCl2, 0.2−5.0 mM ATP, 100 g BSA per ml, 10% glycerol, 1 mM DTT (dl-dithiothreitol) and incubated for 60 min at 37 °C. The released inorganic phosphate was detected colorimetrically as described16.

DNA dependent ATPase activity was calculated from the net absorbance change in the presence and absence of inhibition.

Generation and sequencing of resistant viral mutants.
Naturally occurring, resistant viral mutants were selected in the presence of 1 M BAY 57-1293 or of at least 100 times the IC50 concentration of the compounds listed in Table 1 using the fluorescence based viral replication assay. 1 104 Vero cells were seeded in 96-well MTPs as described above and incubated overnight. Compound was added to the final concentration and the cells were infected with 1,000 p.f.i. (m.o.i. = 0.1) per well. Mutants (viral plaques) were identified with a microscope after 3−5 d incubation or by storing replica samples of 10 l of each well and analyzing the 20−40 MTP with the fluorescence dye fluorescein diacetate as described above. If a resistant virus is present in an individual well, the fluorescence read-out decreases at least by a factor of 3 as compared with mutant-free wells. Mutant-positive supernatants or stored samples were used to produce stocks, the titer was determined, the DNA prepared8 and sequenced (Custom sequencing, Qiagen).

Murine lethal challenge model.
50 l virus suspension (HSV-1 Walki or HSV2MS) in ice-cold PBS (5 104 p.f.u.) was applied to the nares of lightly ether-anesthetized BALB/cABom female mice12, 13, resulting in a mortality of 90−100% after 7−10 d. For oral treatment compounds were suspended in 0.5% Tylose (MH 4000 P2, Clariant, Muttenz, Switzerland) in PBS via ultrasonication. The suspension was subsequently administered via oral gavage in a total volume of 200 l/dose twice daily at the day of infection and 3 daily (7:00 AM, 2:00 PM and 7:00 PM) from d1 to d4 p.i. Infected animals were inspected daily for signs of disease (encephalitis, paralysis) and moribund animals were killed.

Murine zosteriform spread model.
C3H/TifBom-hr female mice were anesthetized by ether and the lateral side of the body was scratched 10 times in a crossed-hatch pattern with a 27-gauge needle. 10 l virus suspension (1 106 p.f.u. HSV-2G) was inoculated on the scarified area and rubbed using the pipette tip14. Mice were inspected daily and disease severity was determined using a scoring system: 0, no signs of infection visible; 1, vesicle formation; 2, slight zoster spread; 3, large patches of zoster formed; 4, confluent zoster band; 5, hind limb paralysis; 6, death. Moribund animals were killed.

Guinea pig model of genital herpes.
Female Hartley guinea pigs were infected intravaginally15 with 2.5 105 p.f.u. HSV-2 strain MS. Depending on the therapy regimen examined, treatment started 6 h p.i. and continued for 4 more days ('very early episodic therapy'), or started at d4 p.i. and lasted for 10 d ('delayed episodic therapy') or started at d20 p.i. and continued for 20 d ('suppression therapy'). Animals were examined daily for herpes lesions and the lesion severity was scored on a 0−4 scale. During d1−d4, p.i. samples of vaginal secretion were obtained using cotton tipped swabs. Individual swabs were placed in tubes with 1 ml Dulbecco's MEM and processed as described15. Virus titers were determined using standard plaque test procedures8.

Antiviral compounds used in animal models.
BAY 57-1293 was synthesized at Bayer AG, Central Research, Leverkusen and micronized using a conventional air-jet mill. Acyclovir was purchased as Zovirax injection flasks (GlaxoSmithKline), valacyclovir as Valtrex film tablets (GlaxoSmithKline).

Top



Received 2 July 2001; Accepted 13 February 2002

REFERENCES
Knipe, D.M. & Howley, P.M. Fields Virology, 4th edn. 2399–2509 (Lippincott Williams Wilkins, Philadelphia, 2001).
Boehmer, P.E. & Lehmann I.R. Herpes simplex virus replication. Ann. Rev. Biochem. 66, 347–384 (1997). | Article | PubMed | ISI | ChemPort |
Schaeffer, H.J. et al. 9-(2-Hydroxyethoxymethyl)guanine activity against viruses of the herpes group. Nature 272, 583–585 (1978). | PubMed | ISI | ChemPort |
Keating, M.R. Antiviral agents for non-human immunodeficiency virus infection. Mayo Clin. Proc. 74, 1266–1283 (1999). | PubMed | ISI | ChemPort |
Fischer, R. et al. Thiazole urea derivatives and their utilization as antiviral agents. Patent application WO-00/53591-A, PCT/EP01498 EP1161423 (2000).
Fischer, R. et al. Thiazole amide derivatives and their utilization as antiviral agents. Patent application WO-01/47904, PCT/EP01498 EP1161423 (2001).
O'Brien, J.J. & Campoli-Richards, D.M. Acyclovir—an updated review of its antiviral activity, pharmacokinetic properties and therapeutic efficacy. Drugs 37, 233–309 (1989). | PubMed | ChemPort |
Brown, S.M. & MacLean, A.R. Herpes Simplex Virus Protocols (Humana, Totowa, New Jersey, 1998).
Crumpacker, C.S., Schnipper, L.E., Zaia, J.A. & Levin M.J. Growth inhibition by acycloguanosine of herpesviruses isolated from human infections. Antimicrob. Agents Chemother. 15, 642–645 (1979). | PubMed | ISI | ChemPort |
Collins, P. & Darby G. Laboratory studies of herpes simplex virus strains resistant to acyclovir. Rev. Med. Virol. 1, 19–28 (1991). | ChemPort |
Hall, M.C. & Matson, S.W. Helicase motifs: the engine that powers DNA unwinding. Mol. Microbiol. 34, 867–877 (1999). | Article | PubMed | ISI | ChemPort |
Field, H.J., Anderson, J.R. & Efstathiou, S. A quantitative study of the effects of several different nucleoside analogues on established herpes encephalitis in mice. J. Gen. Virol. 65, 707–719 (1984). | PubMed | ISI | ChemPort |
de Clercq, E. & Luczac, M. Intranasal challenge of mice with herpes simplex virus: an experimental model for the evaluation of the efficacy of antiviral drugs. J. Inf. Dis. 133, A226–A236 (1976).
Simmons, A. & Nash, A.A. Zosteriform spread of herpes simplex virus as a model of recrudescence and its use to investigate the role of immune cells in prevention of recurrent disease. J. Virol. 52, 816–821 (1984). | PubMed | ISI | ChemPort |
Kern, E.R. & Glasgow L. Treatment of genital herpes simplex virus infections in guinea pigs. in Herpesvirus, Proceedings of a Burroughs Wellcome–UCLA Symposium (ed. Rapp, F.) 617–636 (Alan R. Liss Inc., New York, 1984). | ChemPort |
Spector, F.C., Liang, L., Giordano, H., Sivaraja, M. & Peterson, M.G. Inhibition of herpes simplex virus replication by a 2-amino thiazole via interactions with the helicase component of the UL5-UL8-UL52 complex. J. Virol. 74, 6979–6987 (1998).
Top



Acknowledgments
We thank J. Blümel for clinical field isolates (UB1-31, UB33-47 & UB49-56) of HSV-1 and HSV-2; P. Spear and L. Kwan for analyzing herpesvirus entry into cells; P. Schaeffer for ICP-4 plasmids; S. Weller for recombinant baculoviruses; H.R. Hehnen for material and lab space to carry out the animal virus experiments (equine, porcine and bovine herpes strains).; M. Becka for statistical analysis of data; and K. Ostertag-Palm, M. Hucke, C. Stamm, E. Clemente, M. Werth, J. Wann, I. Hulsmann, S. Schaab, S. Vogel, S. Veldhoen, D. Ganzer, G. Köppe, J. Hotho, J. Leske, U. Zuther, H. Schoop, O. Augustin, M. Peters, J. Dornieden, H. Blum, E. Lindner, G. Heckmann, E. Carrozzo, B. Schulz, H. Küper, U. Reimann, M. Heidtmann, D. Höpker, A. Haas, A. Rudek, J. Daheim, J. Verlage, B. Poschmann, M. Heine and P. Hartmann for technical assistance.









Home | About us | FAQ | Support | Quotes | Related Links

© 2004 oral-HIV-Tests. All right reserved.